mar9ive3eMichooco mar9ive3eMichooco

02-03-2017
Mathematics

contestada

Paul tries to act stoic and about his brother being drafted to serve in the army, but his pained expression gives him away.

Respuesta :

camkirky camkirky

07-03-2017

Detached is correct.

Answer Link

screamingdancer7 screamingdancer7

13-03-2017

If you are working on a fill in the blank question, I believe the answer is DETACHED

Answer Link

Otras preguntas

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Need help with practice test step by step answer #2

Find the measure of the angles between the hands of the clocks at a) 8:54 b) 5:11 and c) 8:03I have the answers, but I need an explanation

A Snap Cube PrismA rectangular prism is 3 units high, 2 units wide, and 5 units long. What is its surfacearea in square units? Explain or show your reasoning (w

what are the lewis structures for the following:O3HOClHCN

Find the surface area of a sphere with a radius of 1 cm to the nearest tenth. (Do NOTtypeinany units in your answer.)

what is the maximum profit

Im a fishing wizard! What figurative language is being used? Simile Metaphor Idiom Personification Illusion Hyperbole

f(x) = 4x - 3g(x) = x^3 + 2xFind (f-g)(4)

Allan’s friend drove him from Philadelphia to Arlington. The distance is 122 miles and the trip took 2 hours. How fast was Allan’s friend driving?