trapboypopie trapboypopie
  • 02-02-2022
  • Mathematics
contestada

I need help with this
(-7)(-5) =

Respuesta :

selthehuman selthehuman
  • 02-02-2022
answer would be 35 as minus times minus is positive
Answer Link

Otras preguntas

What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Round 46.895 to the nearest tenth
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5