Kian7ahchavena Kian7ahchavena
  • 03-12-2016
  • Spanish
contestada

It takes 50 seconds to discharge 750 cc from a small sprayer how long should you spray if you want to discharge only 330 cc

Respuesta :

maxine101
maxine101 maxine101
  • 04-12-2016
420 I think I'm not sure tho
Answer Link

Otras preguntas

In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
the reproductive system of a male mammal provides
Write expression using the distributive property to find the product of 7 times 63
Give a recursive algorithm for finding the sum of the first n odd positive integers.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
solve the simultaneous equation 4x+7y=1 3x+10y=15
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit