pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Tori deposited $5,000 in an imvestment acount for a college that wil give you $175 for evey year that her money stays in the account. write a Linear model that
1,200 cups per hour equals how many gallons per minute.
1 (9x+2)=4+ 2 (6x+4) 3 3
How was European society organized during the early Middle Ages?
If you roll the cube 60 times, how many numbers less than 3?
Determine whether each number is a solution of the inequality below. 3x+4<-7
please help with question 1
What is needed for your immune system to create an appropriate antibody to protect against a particular disease?
Mr. Gengel wants to make a shelf with boards that are 1 1/3 feet long. If he has board, how an 18-foot many pieces can he cut from the big board?
Read the quote: "No tears in the writer, no tears in the reader." Which best explains the meaning of this quote?​