isabell105 isabell105
  • 01-11-2016
  • Mathematics
contestada

how to find a line slope?

Respuesta :

jaeisoo
jaeisoo jaeisoo
  • 01-11-2016
stack and subtract with the y on top
Answer Link

Otras preguntas

Which Civil Rights era organization is being described by these statements?
Show all work. 1. 14 =- 1(p-8) 2.-27 - 4x)=9 3.-18-n=6(1 +3n) 4. 5x +34 = - 2(3-7x) 5. 2(4x - 3) - 8 = 4 + 2x 6. 3n-5 = - 8(6+5n)
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What is the volume of the cone below? A. 3967 units B. 132 units3 C. 792 units3 D. 264 units3
A manufacturing firm has discontinued the production of a certain unprofitable product line. Considerable excess production capacity was created as a result. Ma
Which of the following factors is needed by online communicators to produce the same amount of impression formation and relationship development as face-to-face
Who limited education Jackson or Adams
Identify the choice that best completes the statement or answers the question. Which type of indirect restorative material combines strength, translucence, and
Why did the unemployment rate go down from 1933 to 1937?
An aluminum metal rod is heated to 300oC and, upon equilibration at this temperature, it features a diameter of 25 mm. If a tensile force of 1 kN is applied axi