Seudónimo Seudónimo

01-02-2021
Mathematics

contestada

{ x + y = 158
x- y = 112

Respuesta :

ddemarvion456 ddemarvion456

01-02-2021

Answer:

i have know

Step-by-step explanation:

Answer Link

Otras preguntas

What is the First Language On world?

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?

how did world war 2 spur job growth in Washington?A: by decreasing competition in foreign tradeB: by encouraging many people to conserve resourcesC: by increasi

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Help plsssssssssssss

4/y+2 - 9/y-2 = 9/y^2-4

What caused the gross domestic product of the united states to quadruple between 1860 and 1890?

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.