cyberteam349 cyberteam349

03-09-2020
Mathematics

contestada

Matt collected 18 fewer football cards than Steven. Matt collected 63 cards, how many cards did Steven collect

Respuesta :

audilucille audilucille

03-09-2020

Steven collected 81 cards. If Matt collected 63 cards, but had 18 fewer cards than Steven, and we want to know how many cards Steven collected, you would add 18 more cards to Matt’s total to get Stevens total.

Answer Link

Otras preguntas

Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find the area of a kite with diagonals 10 & 5

How do you determine the type of ion charge any element will form based on its number of valence electrons?

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

Fractures of the blank of long bones are especially common in young animals

What is the distance between points (-42, 63) and (-39, 67)?

The process through which thoughts and actions become routine is ______.

An increase in immigrants to Texas led to _________ education. A. extracurricular B. higher C. mandatory D. bilingual