meybolgonzalez12
meybolgonzalez12 meybolgonzalez12
  • 04-06-2020
  • Biology
contestada

Based on the diagram above, which organism will have the greatest physical difference from its ancestor?
a) birds (b) lobsters (c) perch (d) mammals

Based on the diagram above which organism will have the greatest physical difference from its ancestor a birds b lobsters c perch d mammals class=

Respuesta :

Kobiemazzetti
Kobiemazzetti Kobiemazzetti
  • 04-06-2020
I believe it’s b lobsters
Answer Link

Otras preguntas

if 2^x-4=4a^x-6 what is the value of a
Arrange the steps in the correct order for creating a digital image and saving it.
who is the present president of liberia
It takes 10 workers 24 hours to do a job. Fill in the chart.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba
Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.
What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
At age 76 years, which chronic condition is elizabeth most likely to have?