saraharnold37640 saraharnold37640
  • 03-10-2018
  • English
contestada

If you are writing an essay and it has to be a certain amount of sentences, do the sentences in the paragraph count as a sentence?

Respuesta :

yg201
yg201 yg201
  • 03-10-2018
Yes, they should count.
Answer Link

Otras preguntas

Lisa’s test grades are 79, 89, and 90. There will be one more test this year. If Lisa wants her test average to be at least 88, what is the lowest grade she can
What are the different ways of interpreting the title of the short story was it a dream
Find the area of a kite with diagonals 10 & 5
a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w
Joseph and cleoma, who made the first cajun recording, were husband and wife
235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes
Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?
In a survey, a group of students were asked to name their favorite day of the week. There were 8 students who chose “other”. How many students participated? Sa
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Describe why plant cells are rigid: